Name That Gene

(adopted from Weber, S. The American Biology Teacher, Volume 65, October 2003)

Answer the following questions in complete sentences:

1. What are the 4 nucleotides that make up a DNA code? What are their common abbreviations?

2. What does DNA code for?

3. What is a gene? Where/how do we find genes?

4. Where are genes located?

5. Explain DNA determines the traits of an organism? Use the words nucleotides, gene and protein in your answer.

6. What do you think can cause a genetic disease?

7. What will happen to an organism's health is a gene for an important protein is defective?

8. What would happen if an organism inherited a gene that coded for defective proteins?

 

Directions for the Name that Gene Activity:

In the following exercise you will be given nucleotide sequences found in real human DNA that are associated with genetic disorders when mutated. Your job is to compare the sequences you are given with the nucleotide sequences of most known genes. Using a search engine for genetic databases, you will be able to; a) name the gene that contains the short DNA sequence that you are investigating, b) locate the gene on its corresponding chromosome, and c) describe the disorder that results when that gene is defective.

Protocol for retrieving gene sequences:

1. Connect to the internet. Go to http://www.ncbi.nlm.nih.gov (National Center for Biological Information). Click the word BLAST on the top blue bar. or go to

Search a nucleotide database using a nucleotide query
Algorithms: blastn, megablast, discontiguous megablast

2. Locate the heading "Nucleotide-nucleotide BLAST" and click on that word.

3. Type in only ONE of the exact nucleotide sequences (listed in the next section of this activity) in the top box of the window. Click BLAST.

4. On the next screen that shows up, and then you will have to wait until the search engine finds looking for your sequence. (or just look down lower on the page).

5. When the search finishes, scroll down the screen until you find the start of the list showing the most relevant finds. Note the name of the gene on the first blue line. Then click on the first blue reference line. This will tell you the name of the gene and location on a chromosome if that information is available. Once you have identified your gene return to the first screen at NCBI. (write down the name of the gene and what chromosome #1-23 the gene is located on).

6. Located on the top of the screen (you may need to scroll down the drop down menu) is OMIM (online Mendelian inheritance in Man) on the top right drop down menu "SEARCH" and then paste the name of the gene into "FOR" box and then search.

7. Click on the first return and that goes to the explanation of the gene. Look down the reference until you find what diseases are associated with this gene. (usually under the topic heading of Molecular Genetics).

8. Do an internet search or find the "Gene and Disease" site on the NCBI site (note the NCBI site changes and you may have to do a search for Gene and Disease) to answer the following questions:

   1) What causes the disorder/disease you searched for?

    2) Are there any treatments?

    3) How is the disorder/disease inherited?

 

Pick only one sequence to investigate:

Sequence #1 (Done in class as a demo, do not do for credit)

ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCCGCC

Sequence #2

ATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTGCTCCTGCTGTCCATCCTCCACCCCTCTCGGCCT GGAGGGGTCCCTGGGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTT

Sequence #3

ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATGAGCGGACGTCCCTAATGTCGGCCGAGAGCCCC ACGCCGCGCTCCTGCCAGGAGGGCAGGCAGGGCCCAGAGGATGGAG

Sequence #4

ATGTTTTATACAGGTGTAGCCTGTAAGAGATGAAGCCTGGTATTTATAGAAATTGACTTATTTTATTCTCATATTTACATGTGC ATAATTTTCCATATGCCAGAAAAGTTGAATAGTATCAGATTCCAAATCT

Sequence #5

ATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCC AATTTGGAGGCTGGGAAGGTGAAGGAAACCAGAGCCAGTCGGGCC

Sequence #6

ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCCCCGGCACCGCCGCCGCC GCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAGGAC